View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_63 (Length: 250)
Name: NF7017_low_63
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 28114201 - 28114015
Alignment:
| Q |
13 |
attctggggaaaactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggatttggcttggttagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28114201 |
attctggggaaaactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggatttggcttggttagta |
28114102 |
T |
 |
| Q |
113 |
gtactcatcactatcactctctcttactatgtttctaaatattgttgttatttttagttatattgaatgagcaatagatggattgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28114101 |
gtactcatcactatcactctctcttactatgtttctaaatattgttgttatttttagttatattgaatgaggaatagatggattgtt |
28114015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 138
Target Start/End: Complemental strand, 28129739 - 28129618
Alignment:
| Q |
10 |
attattctggggaaaactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggatttggcttggtta |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||| | | |||| | || |||||||| ||||||||||||||| ||||| |
|
|
| T |
28129739 |
attattctggggaaaactagtctcccagagtggtatggcgctcgttctaccaccatgc---caaaaacttggtgcgctagaggtggatttgcattggt-- |
28129645 |
T |
 |
| Q |
110 |
gtagtactcatcactatcactctctctta |
138 |
Q |
| |
|
|||||||||||||| ||||||||||||| |
|
|
| T |
28129644 |
-tagtactcatcact-tcactctctctta |
28129618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University