View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_68 (Length: 244)
Name: NF7017_low_68
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 28113160 - 28113376
Alignment:
| Q |
19 |
tactcaactgactcacttgcccattggaaaagattcctcctccaagaccacccaccaccatccacatcaaaccaatagaaaacatctccgccaccgattc |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28113160 |
tactcaactgactcacttgcccattggtaaagattcctcctccaagaccacccaccaccatccacatcaaaccaatagaaaacatctccgccaccgattc |
28113259 |
T |
 |
| Q |
119 |
gtctttagtattgttctttttattacatactcccttccttcactattataagcnnnnnnnncatgttaaaaatttccaaaatatatatgtttggaaagtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28113260 |
gtctttagtattgttctttttattacatactcccttccttcactattataagc-aaaaaagcatgttaaaaatttccaaaatatatatgtttggaaagtt |
28113358 |
T |
 |
| Q |
219 |
acatttggtcaatagtta |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28113359 |
acatttggtcaatagtta |
28113376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University