View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_70 (Length: 243)
Name: NF7017_low_70
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_70 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 48453482 - 48453257
Alignment:
| Q |
19 |
cctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacatggttaatgcacaccttttattattattattttttgtggttatcatcct |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48453482 |
cctacaagtttctcctcttttgcagaaacttttggttatggtgagcgaacatggttaatgcacaccttttattattattattttttgtggttatcatcct |
48453383 |
T |
 |
| Q |
119 |
gactttgagcaagaactttgtaaattaagttatacatttgatccttc-ttcnnnnnnnnnnnnggttatacttttgagctggagaatcatgcaatcaaga |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48453382 |
gactttgagcaagaacttcgtaaattaagttatacatttgatacttctttaaaaaaaaaaaaaggttatacttttgagctggagaatcatgcaatcaaga |
48453283 |
T |
 |
| Q |
218 |
tcgttgcatttaaacatgctaatatt |
243 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
48453282 |
tcgttgcatttaaacatcctaatatt |
48453257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University