View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_73 (Length: 236)
Name: NF7017_low_73
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 39379224 - 39379021
Alignment:
| Q |
14 |
gtttcgtgttactggtttatcactaccaaattctcagcttgttagttcaattccttctgatcttgctaccattgaacaccttcaaattcttgatctttct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39379224 |
gtttcgtgttactggtttatcactaccaaattctcagcttgttagttcaattccttctgatcttggtaccattgaacaccttcaaattcttgatctttct |
39379125 |
T |
|
| Q |
114 |
aataattccattaatgggtctctttcttcaaacttttttcagccaaattctgagctacgttttcttaatttttcgaacaatttgttaacaggtgaagttc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39379124 |
aataattccattaatgggtctctttcttcaaacttttttcagccaaattctgagctatgttttcttaatttttcgaacaatttgttaacaggtgaagttc |
39379025 |
T |
|
| Q |
214 |
caga |
217 |
Q |
| |
|
|||| |
|
|
| T |
39379024 |
caga |
39379021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University