View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_78 (Length: 224)
Name: NF7017_low_78
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 25 - 209
Target Start/End: Complemental strand, 29337100 - 29336917
Alignment:
| Q |
25 |
gatctcagaagcaagcaaccatcagtttgaacttgaa-cttaagagagggtatgtaacactctttattttcaacctgttctaaacttctgattgtgttct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29337100 |
gatctcagaagcaagcaaccatcagtttgaacttgaaacttaagagagggtatgtaacactctttattttcaacctgttctaaacttctgactgtgttct |
29337001 |
T |
|
| Q |
124 |
ttcttggtttctaggtaatttagaacttataatcactagattttcatcatctcattcatgctctagttttgcaccaccaccaaact |
209 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29337000 |
ttcttggtttctaggtaa--cactctttataatcactagattttcatcatctcattcatgctctagttttgcacccgcaccaaact |
29336917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University