View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7017_low_81 (Length: 216)
Name: NF7017_low_81
Description: NF7017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7017_low_81 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 200
Target Start/End: Original strand, 41125011 - 41125194
Alignment:
| Q |
17 |
attctcttcaactcatctggttcacaaggaattgcaagtgctccaacttgagagaatccaaactcttcttcagcttgctttaacaatttcacaaattcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125011 |
attctcttcaactcatctggttcacaaggaattgcaagtgctccaacttgagagaatccaaactcttcttcagcttgctttaacaatttcacaaattcag |
41125110 |
T |
|
| Q |
117 |
gatgatctaaatattccaattcaatacaaaatctttctgttttccacccttgtgttgcaatcaccacaaaatgaccttgcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41125111 |
gatgatctaaatattccaattcaatacaaaatctttctgttttccacccttgtgttgcaatcaccacaaaatgaccttgcttca |
41125194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University