View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7018_high_5 (Length: 275)
Name: NF7018_high_5
Description: NF7018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7018_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 265
Target Start/End: Complemental strand, 3522627 - 3522378
Alignment:
| Q |
16 |
caaaggatccatcttaaaaacaacccaagagtaagcatattatgtatcttatagttcaaccagttgccatacggaggaagcataggaagcaccatggcaa |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3522627 |
caaaggatccatcttaaaaacaagccaagagtaagcatattatgtatcttatagttcaaccagttgccatacggaggaagcataggaagcaccatggcaa |
3522528 |
T |
 |
| Q |
116 |
acacaaaaacaggaacagaaaacaagcagcttaacaaaaactgatccctatacatgtgaatttcattaaccttatccctttctcttcgccccgaaggaga |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3522527 |
acacaaaaacgggaacagaaaacaagcagcttaacaaaaactgatccctatacatgtgaatttcattaaccttatccctttctcttcgccccgaaggaga |
3522428 |
T |
 |
| Q |
216 |
atacaaagttgctcgatacaccttggagccacggctagcttcttgaacac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3522427 |
atacaaagttgctcgatacaccttggagccacggctagcttcttgaacac |
3522378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University