View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7018_high_6 (Length: 273)
Name: NF7018_high_6
Description: NF7018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7018_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 23036402 - 23036634
Alignment:
| Q |
18 |
tttatgtctgtatgaactacaactagagatgaaccagattaggtgttcatcgggcctcacagtactaacgatgaattactcgttgatttgggtttgtgta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
23036402 |
tttatgtctgtatgaactacaactagagatgaaccagattaggtgttcatcaggcctgaca---ctaacgatgaattactcgttgatttgggtttgtgaa |
23036498 |
T |
 |
| Q |
118 |
ttcgaaccattgctttatgaatggagacatttctatgnnnnnnnnntaggtacttctgtcgtaagatttgtagatttagaaatttatatttaaagtaaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23036499 |
ttcgaaccattgctttatgaatggagacatttctatg--aaaaaaataggtacttctgtcgtaagatttgtagatttagaaatttatatttaaagta--a |
23036594 |
T |
 |
| Q |
218 |
aaaaagtgacaggagaaaagaaacagatgaatttgacaca |
257 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
23036595 |
aaaaagtgacaggacaaaagaaatagatgaatttgacaca |
23036634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University