View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7018_low_10 (Length: 207)

Name: NF7018_low_10
Description: NF7018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7018_low_10
NF7018_low_10
[»] chr7 (1 HSPs)
chr7 (1-207)||(24173065-24173271)


Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 24173065 - 24173271
Alignment:
1 aatttaaatcataacatccatgttgcagaggacttgaagtttttaatatgcgatgattggcactgtagtcgccaatctactggtggcttactgaccacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
24173065 aatttaaatcataacatccatgttgcagaggacttgaagtttttaatatgcgatgattggcactgtagtcgccaatctagtggtggcttactgaccacat 24173164  T
101 tctcaaatttaaaatgcagctgcgggaagtttctgtctcaagcaatatctcttgctgatacacaaaagattgataatgaaggatttgttgcagaagcagt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
24173165 tctcaaatttaaaatgcagctgcgggaagtttctgtctcaagcaatatctcttgctgataaacaaaagattgataatgaaggatttgttgcagaagcagt 24173264  T
201 gactttt 207  Q
    |||||||    
24173265 gactttt 24173271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University