View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7018_low_4 (Length: 363)
Name: NF7018_low_4
Description: NF7018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7018_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 348
Target Start/End: Complemental strand, 45281557 - 45281211
Alignment:
| Q |
1 |
actagaaattaagggtgtaaatgagttgaacataaagtgctttgtttcggattaggccaaagcccaatcgattaagggaccgagttgcctcaagtaacta |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45281557 |
actagaaattaagagtgtaaatgagttgaacataaagtgctttgtttcggactaggccaaagcccaatcgattaagggactgagttgcctcaagtaacta |
45281458 |
T |
|
| Q |
101 |
gcttcgacgtggaccatgacgtagactctctctagagatcatacacccaagcagggaaactgacatcatcaaggtcctctctctcatcggatcccagtcc |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45281457 |
gcttcgacgcggaccatgacgtagactctctctagagatcatacacccaagtagggaaactgacatcatcaaggtcctctctctcatcggatccaagtcc |
45281358 |
T |
|
| Q |
201 |
aatgttgtcccatcctaatccactcataggtgtctaaggaggtagttgtctcggctagagttttggatagtaaaaccctaatctcactctacgaaaggct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45281357 |
aatgttgtcccatcctaatccactcataggtgtctaaggaggtaattatctcggctagagttttggatagtaaaaccctaatctcactctacg-aaggct |
45281259 |
T |
|
| Q |
301 |
aactcatggcatccatacacacttttctaacttaaaaacgtcatattt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45281258 |
aactcatggcatccatacacacttttctaacttaaaaacgtcatattt |
45281211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University