View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7019_low_21 (Length: 229)
Name: NF7019_low_21
Description: NF7019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7019_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 26913241 - 26913437
Alignment:
| Q |
18 |
caaaccacctactcacttttcctaggtttgaatccgaagctaaactaccgactcatttttatggcggttttgaaaaccatgaacaaatgctgaaaaatga |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
26913241 |
caaaccacctacccacttttcctaggtttgaatccgaagctaaactaccgacccattttcatggcagttttgaaaaccatgaacaagtgctgaaaaatga |
26913340 |
T |
 |
| Q |
118 |
catggtggtggagccatttatcgagggtgatgattcaaacaatgtttttcatgaggttgtaagtggtggtgaaatggaacaccgtcgttctcatggg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26913341 |
catggtggtggagccatttatcgagggtgatgattcaaacaatgtttttcatgaggttgtaagtggtggtgaaatggaacaccgtcgttctcatggg |
26913437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 3804569 - 3804503
Alignment:
| Q |
140 |
gagggtgatgattcaaacaatgtttttcatgaggttgtaagtggtggtgaaatggaacaccgtcgtt |
206 |
Q |
| |
|
||||||| |||| ||||| ||| ||||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
3804569 |
gagggtggtgatgcaaaccatgcttttcatgaggttattagtggtggagaaatggaacaccgtcgtt |
3804503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University