View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7020_high_21 (Length: 282)
Name: NF7020_high_21
Description: NF7020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7020_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 6 - 234
Target Start/End: Complemental strand, 31662844 - 31662614
Alignment:
| Q |
6 |
gtttggtgtttcaggaggttgtgtctctgggtgctgcactaggcgtttgagcactatgcactaggcgtaggtctgtgtctagttctataatataggctat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31662844 |
gtttggtgtttcaggaggttgtgtctctgggtgctgcactaggcgtttgagcactatgcactaggcgtaggtctgtgtctagttctataatataggctat |
31662745 |
T |
 |
| Q |
106 |
ttcaacacaattttgaggaagaagagtgagacatactagggtttatcaaaaggaagaattttaggcgatcaaaggctaagaatttagtatttttggacta |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
31662744 |
ttcaacacaattttgaggaagaagagtgagacaaactagggtttatcaaaaggaagaattttaagcgatcaaaggctaagaatttagtatttttggaata |
31662645 |
T |
 |
| Q |
206 |
t--tctctagtttcccaacccaaattttcga |
234 |
Q |
| |
|
| ||||||| ||||||||||||||| |||| |
|
|
| T |
31662644 |
ttctctctaggttcccaacccaaattctcga |
31662614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 253 - 282
Target Start/End: Complemental strand, 31662598 - 31662569
Alignment:
| Q |
253 |
ttagagtttattgttgaaggtttatttctt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31662598 |
ttagagtttattgttgaaggtttatttctt |
31662569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University