View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7020_high_26 (Length: 253)
Name: NF7020_high_26
Description: NF7020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7020_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 245
Target Start/End: Complemental strand, 27093668 - 27093445
Alignment:
| Q |
20 |
aaggtgctcatgaaattgaaacattgatggaacctcaaagacaagaccacagttttggtaaaactacctggcacgttgccaacactgaggtgttgctctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27093668 |
aaggtgctcatgaaattgaaacattgatggaacctca--gacaagaccacagttttggtaaaactacctggcacgttgccaacactgaggtgttgctctt |
27093571 |
T |
 |
| Q |
120 |
gttattaaggacagaggaaaagacagcacatgcgctcgcaaattgtaacccaaccacaagatattgagagggtatagaccactttttatgtgtaagcaag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27093570 |
gttattaaggacagaggaaaagacagcacatgcactcgcaaattgtaacccaaccacaagatgttgagagggtatagaccactttttatgtgtaagcaag |
27093471 |
T |
 |
| Q |
220 |
ttgtggtactgctccacgttcatctc |
245 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
27093470 |
ttgtggtactgctccacgttgatctc |
27093445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University