View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7020_low_39 (Length: 217)
Name: NF7020_low_39
Description: NF7020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7020_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 1975758 - 1975587
Alignment:
| Q |
14 |
acatcacaacccaaaatcacacctctccgtaacccaaattcacactacactccgcaacattcttcaaccattccctnnnnnnnnnttcttcaatcatggc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1975758 |
acatcacaacccaaaatcacacctctccgcaacccaaattcacactacactccacaacattcttcaaccattccctaaaaaaaaattcttcaatcatggc |
1975659 |
T |
|
| Q |
114 |
ggcgattccagtgacttcagttccacgcgaagaacgtatcataactggttttaaacaatgtgatgtccatct |
185 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | |||||| |
|
|
| T |
1975658 |
ggtgattccagtgacttcagttccacgcgaagaacgtatcataaccggttttaaacagtgtgacgaccatct |
1975587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University