View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7020_low_44 (Length: 208)
Name: NF7020_low_44
Description: NF7020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7020_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 34007608 - 34007510
Alignment:
| Q |
15 |
aatgaacatacaacaactttatgattactaaaacaactttatcccggtgcaatttcaaaaactaatatactaaatgcaaatatcattttaaaaagtaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34007608 |
aatgaacatacaacaactttatgattactaaaacaactttatcccggtgaaatttcaaaaactaatatactaattgcaaatatcattttaaaaagtaaa |
34007510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 153 - 190
Target Start/End: Original strand, 55353632 - 55353669
Alignment:
| Q |
153 |
cgataggtggggtagtttaagaggtggcagggactatt |
190 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55353632 |
cgataggtggggtagtttcagaggtggcagggactatt |
55353669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University