View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7021_low_5 (Length: 271)
Name: NF7021_low_5
Description: NF7021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7021_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 20 - 255
Target Start/End: Complemental strand, 51416848 - 51416613
Alignment:
| Q |
20 |
cattgcaggtcaattatattggtcaaataatagcgtaccctacaacaactacagatatctgatcttgaataatatgattcacctgcgacatgcacatgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51416848 |
cattgcaggtcaattatattggtcaaataataacgtaccctacaacaactacagatatctgatcttgaataatatgattcacctgctacatgcacatgat |
51416749 |
T |
 |
| Q |
120 |
gtgctatctcactcaatcagcattaacaatgatgatgatccaaccatctctgtgaactcctctgccgcctggtcaacatgaaactctttctgctcctccg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51416748 |
gtgctatctcactcaatcagcattaacaatgatgatgatccaaccatctctgtgaactcctctgccgcctggtcaacatgaaagtctttctgctcctccg |
51416649 |
T |
 |
| Q |
220 |
ccctctccctcgtcatctttacgcgcctccattcat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51416648 |
ccctctccctcgtcatctttacgcgcctccattcat |
51416613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 51413666 - 51413628
Alignment:
| Q |
172 |
tgaactcctctgccgcctggtcaacatgaaactctttct |
210 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
51413666 |
tgaactcttccgccgcctggtcaacatgaaactctttct |
51413628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University