View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7022_high_15 (Length: 217)
Name: NF7022_high_15
Description: NF7022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7022_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 150
Target Start/End: Original strand, 33726187 - 33726317
Alignment:
| Q |
19 |
gtgtgtcagaaagtgcttaatcatgggtaaagattatgcttctagaacatcttttttatttatagatttatctctttggcttttcaatatttaaaagata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33726187 |
gtgtgtcagaaagtgcttaatcatgggtaaagattatgcttctagaacatcttttttatttatagatttatctctttggcttttcaatatttaaaagata |
33726286 |
T |
|
| Q |
119 |
aataacctgattgaatataaaaagatcattta |
150 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| |
|
|
| T |
33726287 |
aataacctgattgtatat-aaaagatcattta |
33726317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 201
Target Start/End: Original strand, 33726691 - 33726727
Alignment:
| Q |
165 |
taattgctaaattagtttcttttgatgaggtgtgtta |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33726691 |
taattgctaaattactttcttttgatgaggtgtgtta |
33726727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University