View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7022_high_8 (Length: 272)
Name: NF7022_high_8
Description: NF7022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7022_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 22 - 257
Target Start/End: Original strand, 36546050 - 36546285
Alignment:
| Q |
22 |
ctgataagcggtttttagtatatcatgaattcgcacgagatgagcagaactctcttaattttggcaataggaatatgcataggctttatggttggagctg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36546050 |
ctgataagcggtttttagtatatcatgaattcgcacgagatgagcagaactctcttaattttggcaataggaatatgcataggctttatggttggagctg |
36546149 |
T |
|
| Q |
122 |
gtttggtgttttcagttttagtcttctgcaggtctggaaggaagcgtgtagatgtggagaagagcggtcctctgagaaccaaggccattaatgttcatgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36546150 |
gtttggtgttttcagttttagtcttctgcaggtctggaaggaagcgtgtagatgtggagaagagcggtcctctgagaaccgaggccattaatgttcatgg |
36546249 |
T |
|
| Q |
222 |
caaaggggctgattccagtgtaacatcgttatcaga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36546250 |
caaaggggctgattccagtgtaacatcgttatcaga |
36546285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University