View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7022_high_9 (Length: 256)

Name: NF7022_high_9
Description: NF7022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7022_high_9
NF7022_high_9
[»] chr1 (1 HSPs)
chr1 (1-236)||(27062431-27062666)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 27062666 - 27062431
Alignment:
1 tcttgtttggatgctgcatattcaccttcgtcgccacggcggttcgcggcgccggttaccttcctctacaactaaacgttcctcttaaccaccgcgttga 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||    
27062666 tcttctttggatgctgcatattcaccttcgtcgccacggcggttcacggcgccggttaccttcctctacaacgaaacgttcctcttaaccaccgcgttga 27062567  T
101 gatagacacgcttagagctcgtgacagagttcgccatgggagaattttgcgtgctagtgttggtggtgttgtcgacttcagagttcaaggctcttccgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27062566 gatagacacgcttagagctcgtgacagagttcgccatgggagaattttgcgtgctagtgttggtggtgttgtcgacttcagagttcaaggctcttccgat 27062467  T
201 ccatccactcttgggtacgggtaataatcgtaatca 236  Q
    ||||||||||||||||||||||||| ||||||||||    
27062466 ccatccactcttgggtacgggtaattatcgtaatca 27062431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University