View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7022_low_14 (Length: 251)
Name: NF7022_low_14
Description: NF7022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7022_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 51109493 - 51109272
Alignment:
| Q |
30 |
cactataggtgttgtaaagaattattttgctggtaaacaaagaaaagaaagtacttgtaatttcaatattgatcacaagtgaaaaagaaggttggacaca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51109493 |
cactataggtgttgtaaagaattattttgctcgtaaacaaagaaaagaaagtacttgtaatttcaatattgatcacaagtgaaaaagaaggttggacaca |
51109394 |
T |
 |
| Q |
130 |
gtcacagacgcaagccaaaaaagaaggctggaaagtggaaacattcacactcactaatgtgtatttttagaagttgcacaactaactaataaacaaacac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51109393 |
gtcacagacgcaagccaaaaaagaaggctggaaagtggaaacattcacactcactaatgtgtatttttagaagttgcacaactaactaataaacaaacac |
51109294 |
T |
 |
| Q |
230 |
caaacctcagttacggttaatt |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51109293 |
caaacctcagttacggttaatt |
51109272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University