View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7022_low_19 (Length: 217)

Name: NF7022_low_19
Description: NF7022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7022_low_19
NF7022_low_19
[»] chr2 (2 HSPs)
chr2 (19-150)||(33726187-33726317)
chr2 (165-201)||(33726691-33726727)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 150
Target Start/End: Original strand, 33726187 - 33726317
Alignment:
19 gtgtgtcagaaagtgcttaatcatgggtaaagattatgcttctagaacatcttttttatttatagatttatctctttggcttttcaatatttaaaagata 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33726187 gtgtgtcagaaagtgcttaatcatgggtaaagattatgcttctagaacatcttttttatttatagatttatctctttggcttttcaatatttaaaagata 33726286  T
119 aataacctgattgaatataaaaagatcattta 150  Q
    ||||||||||||| |||| |||||||||||||    
33726287 aataacctgattgtatat-aaaagatcattta 33726317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 201
Target Start/End: Original strand, 33726691 - 33726727
Alignment:
165 taattgctaaattagtttcttttgatgaggtgtgtta 201  Q
    |||||||||||||| ||||||||||||||||||||||    
33726691 taattgctaaattactttcttttgatgaggtgtgtta 33726727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University