View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7023_low_7 (Length: 278)
Name: NF7023_low_7
Description: NF7023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7023_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 33500261 - 33500049
Alignment:
| Q |
18 |
tgccctacaaaagaagctttgcttgtgtataaaggaaagtgatagtgtatatgacaacaaaagactttaactttaaggatggacgtaaaaaagtcatctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33500261 |
tgccctacaaaagaagctttgcttgtgtataaaggaaagtgatagtgtatatgacaacaaaagactttaa------ggatggacgtaaaaaagtcatctg |
33500168 |
T |
 |
| Q |
118 |
catgatatacagcatgtcggttgtttattgcatttctttcttcaactgcttcaataagttacatagcatgtgagaaataaattatagaagtgttaatttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33500167 |
catgatatacagcatgtcggttgtttattgcatttctttcttcaaatgcttcaataagttacatagcatgtgagaaataaattatagaagtgttaatttc |
33500068 |
T |
 |
| Q |
218 |
aaagctatttactcttgga |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33500067 |
aaagctatttactcttgga |
33500049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University