View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7023_low_8 (Length: 273)
Name: NF7023_low_8
Description: NF7023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7023_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 12 - 258
Target Start/End: Complemental strand, 44858921 - 44858674
Alignment:
| Q |
12 |
agagatgttgtgataatagtatccagtcaagaggaaacagatacagcttgcacaggcctgtcttgtttcgtttcttaccggcnnnnnnnattagcaatgc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
44858921 |
agagatgttgtgataatagtatccagtcaagaggaaacagatacagcttgcacaggcctgtcttgtttcgtttcttatcggctttttttattagcaatgc |
44858822 |
T |
 |
| Q |
112 |
tgttaccggatagaagtcattttggcaatagcttgcagtatgaacagtcaaaggatcttgtatac-nnnnnnnnnnnnnnaatgcatgacttttaaaata |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44858821 |
tgttactggatagaagtcattttggcaatagcttgcagtatgaacagtcaaaggatcttgtatactttttttttttttttaatgcatgacttttaaaata |
44858722 |
T |
 |
| Q |
211 |
gttggtactttgtgtcttttatttttccaatgctcactgtcaatattg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858721 |
gttggtactttgtgtcttttatttttccaatgctcactgtcaatattg |
44858674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University