View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7024_high_6 (Length: 244)
Name: NF7024_high_6
Description: NF7024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7024_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 33 - 187
Target Start/End: Original strand, 34258326 - 34258480
Alignment:
| Q |
33 |
aagtggtgtttactgaagatgaggatcaatttgattgcccaaataaacccttgttatacagtatatggatgaatcagagaattggtactagcaaatacca |
132 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34258326 |
aagtggtgttaactgaagatgaggatcaatttgattgcccaaataaacccttgttatacagtatatggatgaatcagagaattggtactagcaaatagca |
34258425 |
T |
|
| Q |
133 |
atgattgtgtgtactctaatagagataaaagctttgctaatccgagttgatgaaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34258426 |
atgattgtgtgtactctaatagagataaaagctttgctaatccgagttgatgaaa |
34258480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University