View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7025_high_30 (Length: 280)

Name: NF7025_high_30
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7025_high_30
NF7025_high_30
[»] chr5 (2 HSPs)
chr5 (1-89)||(39061709-39061797)
chr5 (221-264)||(39061619-39061661)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 39061797 - 39061709
Alignment:
1 cccttataaagaggtactttagacaccagttaggaaggcatggcatgtaatttcaactatgctatatctatcccgagacattacatgtc 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39061797 cccttataaagaggtactttagacaccagttaggaaggcatggcatgtaatttcaactatgctatatctatcccgagacattacatgtc 39061709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 39061661 - 39061619
Alignment:
221 gggaaaataagaaagttcttgccctttctatttagggggatttt 264  Q
    |||||||||||||||||||||||||||||| |||||||||||||    
39061661 gggaaaataagaaagttcttgccctttcta-ttagggggatttt 39061619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University