View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_high_38 (Length: 242)
Name: NF7025_high_38
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 28325281 - 28325396
Alignment:
| Q |
1 |
tcaattgggttcaaagtttactacttttcaagaggatccaatggtggataagcttagaactcagttgggtgtgattcacccaattccatcgcctcctatt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28325281 |
tcaattgggttcaaattttactacttttcaagaggatccaattgtggataagcttagaactcagttgggtgtgattcacccgattccatcgcctcctatt |
28325380 |
T |
|
| Q |
101 |
aaccgacacgttgctg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28325381 |
aaccgacacgttgctg |
28325396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 156 - 233
Target Start/End: Original strand, 28325436 - 28325513
Alignment:
| Q |
156 |
ataaattatggacttttagaagaaggaggaacaaagttagtagtgaagatagttttcgcggtgtgtggccacaggttc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28325436 |
ataaattatggacttttagaagaaggaggaacaaagttagtagtgaagatagttttcgcggtgtgtggccgcaggttc |
28325513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University