View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_high_42 (Length: 234)
Name: NF7025_high_42
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_high_42 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 31067 - 30865
Alignment:
| Q |
19 |
gacacaaccccttttgttgaagaatacttcactgtaccagaacaccattatgattggaatggagttaacccaccacaaacttatattgccaatttactaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31067 |
gacacaaccccttttgttgaagaatacttcactgtaccagaacaccattatgattggaatggagttaacccaccacaaacttatattgccaatttactaa |
30968 |
T |
 |
| Q |
119 |
aggtatgaatagattgatttttcacatttaaatttttcttggtatttatattatgtagcactgacactttagattaaatatgagtatagtgtttgacgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30967 |
aggtatgaatagattgatttttcacatttaaatttttcttagtatttatattatgtagcactgacactttagattaaatatgagtatagtgtttgacatg |
30868 |
T |
 |
| Q |
219 |
tgt |
221 |
Q |
| |
|
||| |
|
|
| T |
30867 |
tgt |
30865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University