View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_high_50 (Length: 202)
Name: NF7025_high_50
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_high_50 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0200 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 30893 - 30707
Alignment:
| Q |
1 |
taaatatgagtatagtgtttgacatgtgtcggtgtcggacaccggcgcaacacaaatacattatatttaatttcttctatttctcaaaatattattattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30893 |
taaatatgagtatagtgtttgacatgtgtcggtgtcggacaccggcacgacacaaatacattatatttaatttcttctatttctcaaaatattattattg |
30794 |
T |
|
| Q |
101 |
ccgcgtcagtgtaattgtcgttttaagtattcgtatttgttttggtgcttcatacactcattattctacattgtggagcagggcaca |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30793 |
ccgcgtcagtgtaattgtcgttttaagtattcgtatttgtttcggtgcttcatacactcattattctacattgtggagcagggcaca |
30707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University