View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_low_20 (Length: 390)
Name: NF7025_low_20
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 8 - 374
Target Start/End: Complemental strand, 28325282 - 28324916
Alignment:
| Q |
8 |
gaacctgtggatcccttaattcaacttcaccaccttcaacttcaagttcatcatttgaatttgaaattctgccatcaaaaacaaaacttttcgcacccct |
107 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28325282 |
gaacctgcgaatcccttaattcaacttcaccaccttcaacttcaagttcatcatttgaatttgaaattctgccatcaaaaacaaaacttttcgcacccct |
28325183 |
T |
 |
| Q |
108 |
tttagcagaattagcgaatttggaattggaagtagttgcagattgtttttgaatagaagaggaataaagggtccannnnnnnctacggaatttgcgatat |
207 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28325182 |
tttagaagaattagcgaatttgggattggaagtagttgcagattgtttttgaatagaagaggaataaagggtccatttttttctacggaatttgcgatat |
28325083 |
T |
 |
| Q |
208 |
gagtagtgatttgaaaataagcgctttttcatggttttggaaaggggaaaggaaagaagagaattggaagcataattgttgttgcagggacaaagagaga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28325082 |
gagtagtgatttgaaaataagcgctttttcatggttttggaaaggggaaaggaaagaagagaattggaagcataattgttgttgcagggacaaagagaga |
28324983 |
T |
 |
| Q |
308 |
agtgaaaagtaggagaagcttgttgaagaatcatgaatggatatggatagaagagaagagaatgaac |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28324982 |
agtgaaaagtaggagaagcttgttgaagaatcatgaatggatatggatagaagagaagagaatgaac |
28324916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University