View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_low_31 (Length: 301)
Name: NF7025_low_31
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 20 - 290
Target Start/End: Complemental strand, 44965606 - 44965336
Alignment:
| Q |
20 |
aagccgtcactgtcatcccctcgccggagaatttcaccttatcaccatacctcttcgaaaccttaacataaagaggcttaatcagcttcaaatatttctg |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965606 |
aagctgtcactgtcatcccctcgccggagaatttcaccttatcaccatacctcttcgaaaccttaacataaagaggcttaatcagcttcaaatatttctg |
44965507 |
T |
|
| Q |
120 |
caaaatctcctttgaaactcgctctgttttaggttcctctgttccttgattccgaattttgctaccaaagcttctagtgctgttatctctactaagcatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44965506 |
caaaatctcctttgaaactcgctctgttttaggttcctctgttccttgattccgaattttgctaccaaagcttcttgtgctgttatctctactaagcatt |
44965407 |
T |
|
| Q |
220 |
ggagtagaatgaaaatcttgttcgatgtttagtttcacagaaaaaactttggtttctttcttctgattctt |
290 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965406 |
ggagtagaatgaaaatcatgttcgatgtttagtttcacagaaaaaactttggtttctttcttctgattctt |
44965336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University