View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_low_33 (Length: 280)
Name: NF7025_low_33
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 39061797 - 39061709
Alignment:
| Q |
1 |
cccttataaagaggtactttagacaccagttaggaaggcatggcatgtaatttcaactatgctatatctatcccgagacattacatgtc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39061797 |
cccttataaagaggtactttagacaccagttaggaaggcatggcatgtaatttcaactatgctatatctatcccgagacattacatgtc |
39061709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 39061661 - 39061619
Alignment:
| Q |
221 |
gggaaaataagaaagttcttgccctttctatttagggggatttt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39061661 |
gggaaaataagaaagttcttgccctttcta-ttagggggatttt |
39061619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University