View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7025_low_48 (Length: 222)
Name: NF7025_low_48
Description: NF7025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7025_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 8052949 - 8053137
Alignment:
| Q |
23 |
atatatcaattggataagatagtaaactaaataatctcttccggcttaactagatatcatgaatttgaatccaattttaagaatgcagtgcagttaaatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8052949 |
atatatcaattggataagatagtaaactaaataatctcttccggcttaactagatatcatgaatttgaatccaattttaagaatgcagcgcagttaaatt |
8053048 |
T |
 |
| Q |
123 |
tcttgatggagagatttttcatctattgcaatcatatccaaggttataaattaatctctacaattatgcgtagaagatattcatctcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8053049 |
tcttgatggagagatttttcatctattgcaatcatatccaagattataaattaatctctacaattatgcgtagaagatattcatgtcac |
8053137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University