View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7026_high_7 (Length: 227)
Name: NF7026_high_7
Description: NF7026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7026_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 67 - 209
Target Start/End: Complemental strand, 27329646 - 27329507
Alignment:
| Q |
67 |
gagagcacaacattcaatatactttcctttctctcttcacagtctgcaacagccagcttgttgagtgcagaatttatacttttgtggcaacatttgtcca |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329646 |
gagagcacaacattcaatatactttcctttctctcttcacagtctgcaacagccagcttattgagtgcagaatttatacttttgtggcaacatttgtcca |
27329547 |
T |
 |
| Q |
167 |
tgtctgagagcagtactatttagcaaatagacgtgttccctct |
209 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27329546 |
tttctgagagc---actatttagcaaatagacgtgttccctct |
27329507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University