View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7026_high_7 (Length: 227)

Name: NF7026_high_7
Description: NF7026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7026_high_7
NF7026_high_7
[»] chr7 (1 HSPs)
chr7 (67-209)||(27329507-27329646)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 67 - 209
Target Start/End: Complemental strand, 27329646 - 27329507
Alignment:
67 gagagcacaacattcaatatactttcctttctctcttcacagtctgcaacagccagcttgttgagtgcagaatttatacttttgtggcaacatttgtcca 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
27329646 gagagcacaacattcaatatactttcctttctctcttcacagtctgcaacagccagcttattgagtgcagaatttatacttttgtggcaacatttgtcca 27329547  T
167 tgtctgagagcagtactatttagcaaatagacgtgttccctct 209  Q
    | |||||||||   |||||||||||||||||||||||||||||    
27329546 tttctgagagc---actatttagcaaatagacgtgttccctct 27329507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University