View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7026_low_9 (Length: 257)
Name: NF7026_low_9
Description: NF7026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7026_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 48109027 - 48109256
Alignment:
| Q |
17 |
aaaataaaattatgttacagttccttccaccaatccatccatc----atccaacatgtgaacctaatcgtatgctttaattgtaatnnnnnnn-tcatgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
48109027 |
aaaataaaattatgttacagttccttccaccaatccatccatccatcatccaacatgtgaacctaatagtatgctttaattgtaataaaaaaaatcatgg |
48109126 |
T |
 |
| Q |
112 |
aaataagagaattttgagcgatgagatgataactcactcagagaagaagatctgtgcaaagcgagttgagattctggaaacaaggaggaactcaccgaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48109127 |
aaataagagaattttgagcgatgagatgataactcactcagagaagaagatatgtgcaa-gcgagttgagattctggaaacaaggaggaactcaccgaat |
48109225 |
T |
 |
| Q |
212 |
tatgtttcagcggcaccgctattctattcac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48109226 |
tatgtttcagcggcaccgctattctattcac |
48109256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University