View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7027_high_2 (Length: 294)
Name: NF7027_high_2
Description: NF7027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7027_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 7665992 - 7666271
Alignment:
| Q |
1 |
atccttgagatactttgatgtccacctgcaaagaagaatttgagtaacaaatgaggttacaaccagagagaggacaattatactatgatattagcagtgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
7665992 |
atccttgagatactttgatgtccacctgcaaagaagaatttgagtaacaaatgaggttaca----gagagaggacaattatactatgatataagcagtgt |
7666087 |
T |
 |
| Q |
101 |
ggaactaaaaatgttgcctagagaatcgtgattcacaagaaagagagagtgtgcaggcaagaagggattcaacatcaagagatgggggttaaaagactga |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666088 |
ggaaataaaaatgttgcctagagaatcgtgattcacaagaaagag--agtgtgcaggcaagaagggattcaacatcaagagatgggggttaaaagactga |
7666185 |
T |
 |
| Q |
201 |
cacataccacttgccagtaggcacatcaaatacaggggaagaatatcaaaccatgtgaacaacggcgcaataagaaagtaacacca |
286 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666186 |
cacataccacttgccaataggcacatcaaatacaggggaagaatatcaaaccatgtgaacaacggcgcaataagaaagtaacacca |
7666271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University