View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7027_high_3 (Length: 263)
Name: NF7027_high_3
Description: NF7027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7027_high_3 |
 | |
|
| [»] chr7 (4 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 139 - 263
Target Start/End: Original strand, 36529840 - 36529964
Alignment:
| Q |
139 |
caggttcttagttttgtacatttacatgtcctatagtatattcacttgccaatgttgttgatggaatggtaacattgtagtcagggaacaggacaaccct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529840 |
caggttcttagttttgtacatttacatgtcctatagtatattcacttgccaatgttgttgatggaatggtaacattgtagtcagggaacaggacaaccct |
36529939 |
T |
|
| Q |
239 |
ctgcatgtacacctggagctgtagg |
263 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
36529940 |
ctgcatgtacacctggagctgtagg |
36529964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 36529702 - 36529774
Alignment:
| Q |
1 |
agtaaaaaataatttaccattttatttatgacaagaatagaaaaggaaatggtatactgtagcttcttttcct |
73 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36529702 |
agtaaaaaataatttaacattttatttatgacaagaatagaaaaggaaatggtatactgtagcttcttttcct |
36529774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 176 - 263
Target Start/End: Original strand, 36535489 - 36535576
Alignment:
| Q |
176 |
atattcacttgccaatgttgttgatggaatggtaacattgtagtcagggaacaggacaaccctctgcatgtacacctggagctgtagg |
263 |
Q |
| |
|
||||||| ||| |||| ||| |||||||||| || ||| | ||||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
36535489 |
atattcatttggcaatattgctgatggaatgttatcatggaagtcagggaacaggacaaccctcagcgtatacacctggagctgtagg |
36535576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 263
Target Start/End: Original strand, 36523066 - 36523131
Alignment:
| Q |
198 |
gatggaatggtaacattgtagtcagggaacaggacaaccctctgcatgtacacctggagctgtagg |
263 |
Q |
| |
|
||||||||||| |||| | ||||| ||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36523066 |
gatggaatggttacatggaagtcaaagaacatgacaaccctctgcatgtacacctggagatgtagg |
36523131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University