View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7028_high_27 (Length: 242)

Name: NF7028_high_27
Description: NF7028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7028_high_27
NF7028_high_27
[»] chr4 (2 HSPs)
chr4 (20-106)||(32278243-32278330)
chr4 (181-242)||(32278333-32278394)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 32278243 - 32278330
Alignment:
20 catgagttgtatgtcttcctgtataaacaaaa-ttcaatgttacaaaacaaacaacatttgacaaattagtttatttcagtaaagcag 106  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
32278243 catgagttgtatgtcttcctgtataaacaaaaattcaatgttacaaaacaaacaacctttgacaaattagtttatttcagtaaagcag 32278330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 181 - 242
Target Start/End: Original strand, 32278333 - 32278394
Alignment:
181 tagattgacatatttgagtttaccaacttacatactacttgttagactgtttgagagtactt 242  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
32278333 tagattgacatattttagtttaccaacttacatactacttgttagactgtttgagagtactt 32278394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University