View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7028_low_11 (Length: 397)
Name: NF7028_low_11
Description: NF7028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7028_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 359; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 1 - 386
Target Start/End: Complemental strand, 32736027 - 32735644
Alignment:
| Q |
1 |
caacctcattaatgaccagtattgtttgccgccctaatggggttatgcctcataaaaggggaaactgcctctcaaaaatgagactgcctggttttgagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32736027 |
caacctcattaatgaccagtattgtttgccgccctaatggggttatgcctcataaaaggggaaactgcctctcaaaaatgagactgcctggttttgagaa |
32735928 |
T |
 |
| Q |
101 |
acatgccggccattggattagataactctttcaacgctttattggctaagataatcccataagtcactcacatcaaatcaaccgttgactttattaacac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32735927 |
acatgccggccattggattagataactctttcaacgctttattggctaagataatcccataagtcactcacatcaaatcaaccgttgactttattaatac |
32735828 |
T |
 |
| Q |
201 |
atataattgctactattgtattctcacaatctcatacgtgagttgtaaccaattatttagtgctagctcttggcatgatcatataacaaatgggacttaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32735827 |
atataattgctactattgtattctcacaatctcatacatgagttgtaaccaattatttagtgctagctcttggcgtgatcatataacaaatgggacttaa |
32735728 |
T |
 |
| Q |
301 |
cttaatagttgcaagctgatgtatatctctgtcattttcagaaaagattgcgcacggttaggattttagggctttcttgggttcat |
386 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32735727 |
cttaatagttgtaagctgatgtata--tctgtcattttcagaaaagattgcgcacggttaggattttagggctttcttgggttcat |
32735644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University