View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7028_low_20 (Length: 288)
Name: NF7028_low_20
Description: NF7028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7028_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 25988149 - 25988339
Alignment:
| Q |
1 |
tcagatcatgcatatttagatatatcgttgtttgataaacaagaagggtgtgctatttctagttaaagaaactttgtcaaaagaaaaaagtcccacataa |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25988149 |
tcagatcatgcatatttggatatatcgttgtttgataaacaagaagggtgtgctatttctagttaaagaaactttgtcaaaagaaaaaagtccaacataa |
25988248 |
T |
|
| Q |
101 |
agatttatggaaagcacaaaatttacatggtacagttccatcttttcttggtcttccctacctgtgtcatgtgctgagtaccatgtctttcaa |
193 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
25988249 |
agatttatggaaagcccaaaatttacatggtacagttccatcttttcttggtcttccctacc--tgtcatgtgctgagtaccatgtctctcaa |
25988339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 169 - 269
Target Start/End: Original strand, 25988421 - 25988522
Alignment:
| Q |
169 |
atgtgctgagtaccatgtctttcaagttccttaaatattnnnnnnnnnnnnn-tcatacatcgtttgatcttgatataatggttattgtgttctaatgga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988421 |
atgtgctgagtaccatgtctttcaagttccttaaatattaaaaagaaaaaaaatcatacatcgtttgatcttgatataatggttattgtgttctaatgga |
25988520 |
T |
|
| Q |
268 |
tc |
269 |
Q |
| |
|
|| |
|
|
| T |
25988521 |
tc |
25988522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University