View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7028_low_24 (Length: 248)
Name: NF7028_low_24
Description: NF7028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7028_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 32278585 - 32278821
Alignment:
| Q |
1 |
attaactacttacttcgtatcggtggtactgatcaactgcaacatcagcattgctgaaatctgttaccttgcctgtaaaaaattacaaatgtgaggtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32278585 |
attaactacttacttcgtatcggtggtactgatcaactgcaacatcagcattgctgaaatctgttaccttgcctgtaaaaaattacaaatgtgaggtaat |
32278684 |
T |
|
| Q |
101 |
gatcagccagaattttagcatattataagtatcatgcatatgaaagtgtatcttaccaaaagtatgagaaaatgtgtcccacacagatggtccccttcca |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32278685 |
gatcagccagaattttagcatattgtaagtatcatgcatatgaaagtgtgtcttaccaaaagtatgagaaaatgtgtcccacacagatggtccccttcca |
32278784 |
T |
|
| Q |
201 |
tcttctttcactgctccttcatactagacacaggttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32278785 |
tcttctttcactgctccttcatactagacacaagttc |
32278821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 226
Target Start/End: Original strand, 19346385 - 19346448
Alignment:
| Q |
163 |
tatgagaaaatgtgtcccacacagatggtccccttccatcttctttcactgctccttcatacta |
226 |
Q |
| |
|
|||| ||||| || ||||| | |||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
19346385 |
tatgtgaaaaagtatcccatatagatggcccccttccatcttcttttactgcaccttcatacta |
19346448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University