View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7028_low_25 (Length: 244)
Name: NF7028_low_25
Description: NF7028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7028_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 40 - 228
Target Start/End: Complemental strand, 24255471 - 24255285
Alignment:
| Q |
40 |
acatgattctaaaaaatcagtcctaaacaacaaatttttcaattgaagcattttatcaaacagcttgtgcgcagcgatgtatgggaatatataacattca |
139 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||| ||| |
|
|
| T |
24255471 |
acatgattctaaaaaatcagtcctaaccaacaaatttttcaattgaagcattttatcaaacagcttgtgcacaacgatgtatgggaa--tataacaatca |
24255374 |
T |
 |
| Q |
140 |
acgatttaatcatacaaaaaatgaacgcgaagnnnnnnnnnnnnntaatggaacctgacggtggagatggattttccggtggtggcgtg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24255373 |
acgatttaatcatacaaaaaatgaacgcgaaggagagggatagagtaatggaacctgacggtggagatggattttccggtggtggcgtg |
24255285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University