View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7028_low_28 (Length: 242)
Name: NF7028_low_28
Description: NF7028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7028_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 32278243 - 32278330
Alignment:
| Q |
20 |
catgagttgtatgtcttcctgtataaacaaaa-ttcaatgttacaaaacaaacaacatttgacaaattagtttatttcagtaaagcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32278243 |
catgagttgtatgtcttcctgtataaacaaaaattcaatgttacaaaacaaacaacctttgacaaattagtttatttcagtaaagcag |
32278330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 181 - 242
Target Start/End: Original strand, 32278333 - 32278394
Alignment:
| Q |
181 |
tagattgacatatttgagtttaccaacttacatactacttgttagactgtttgagagtactt |
242 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32278333 |
tagattgacatattttagtttaccaacttacatactacttgttagactgtttgagagtactt |
32278394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University