View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7030_high_10 (Length: 250)
Name: NF7030_high_10
Description: NF7030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7030_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 2651722 - 2651508
Alignment:
| Q |
16 |
atagacactagaaaccataaaatcttcggacaaaataaacttgggaagggtgaaccataaggtaggatcctaaaggctaaaagtaggattgtcnnnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651722 |
atagacactagaaaccataaaatcttcggacaaaataaacttgggaagggtgaaccataaggtaggatcctaaaggctaaaagtaggattgtcttttttt |
2651623 |
T |
 |
| Q |
116 |
nnnnnnnnnnaaagtttcaaaaagaatgcatgcaggttgaaccttctgtggacacagagaaagtgagaggcattccaaggtttggtcaacatcctaacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651622 |
tgttttttt-aaagtttcaaaaagaatgcatgcaggttgaaccttctgtggacacagagaaagtgagaggcattccaaggtttggtcaacatcctaacaa |
2651524 |
T |
 |
| Q |
216 |
aaattggattggtgat |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2651523 |
aaattggattggtgat |
2651508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University