View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7030_low_8 (Length: 281)
Name: NF7030_low_8
Description: NF7030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7030_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 265
Target Start/End: Complemental strand, 2651266 - 2651018
Alignment:
| Q |
17 |
aatattgagcaataaagaggaaaatgtttttgtcttatgtagcatttgcttgtaggcaatgttttaaaattatgtggtccatgaggctatgacatcagta |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651266 |
aatactgagcaataaagaggaaaatgtttttgtcttatgtagcatttgcttgtaggcaatgttttaaaattatgtggtccatgaggctatgacatcagta |
2651167 |
T |
 |
| Q |
117 |
tttcagagatctatcataaaattataatgtgtatcaggggtggtataacttttgttcatgattttttccattaccaaaagatagcaagtagcaatagtca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2651166 |
tttcagagatctatcataaaattataatgtgtatcaggggtggtataagttttgttcatgattttttccattaccaaaagatagcaagtagcaatagtca |
2651067 |
T |
 |
| Q |
217 |
actacaacatataacttcgttaggaaggatatactgattagtatattat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2651066 |
actacaacatataacttcgttaggaaggatatactgattagtaaattat |
2651018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University