View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7031_low_11 (Length: 208)

Name: NF7031_low_11
Description: NF7031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7031_low_11
NF7031_low_11
[»] chr8 (1 HSPs)
chr8 (12-192)||(35922420-35922600)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 35922600 - 35922420
Alignment:
12 acctgtgcaatgcaaaggcttctctctctcttctaaatatgtgccccatctctctattttacactttcccatactaatctttgtactcactctaacatct 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35922600 acctgtgcaatgcaaaggcttctctctctcttctaaatatgtgccccatctctctattttacactttcccatactaatctttgtactcactctaacatct 35922501  T
112 cactttttcaaccattgcttccatacttctttctctttatcccacactctctctatccctcttccatccttcagtttctca 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35922500 cactttttcaaccattgcttccatacttctttctctttatcccacactctctctatccctcttccatccttcagtttctca 35922420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University