View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7031_low_4 (Length: 440)
Name: NF7031_low_4
Description: NF7031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7031_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 8e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 10164262 - 10164468
Alignment:
| Q |
12 |
acctgtggaggcatacttttgattcgttgattagtacttatgaaatattggctatttgctgataaatgattgcaatttcttgtggaataaggaagagcaa |
111 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10164262 |
acctttggaggcatacttttgattccttgattagtacttatgaaatattggctatttgctgataaatgattgcaatttcttgtgaaataaggaagagcaa |
10164361 |
T |
 |
| Q |
112 |
aatgcaaattttgttcttgaatgatgatgggcacacatgaatataggaaagcacgatgatctatttgcataaaaatgataactttatcataggtgcatgc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10164362 |
aatgcaaattttgttcttgaatgatgatgggcacacatgaatataggaaagcaagatgatttatttgcataaaaatggtaactttatcataggtgcatgc |
10164461 |
T |
 |
| Q |
212 |
atataag |
218 |
Q |
| |
|
||||||| |
|
|
| T |
10164462 |
atataag |
10164468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 285 - 424
Target Start/End: Original strand, 10164559 - 10164697
Alignment:
| Q |
285 |
accaaactcaagagagtcataagttgagggaagattggcatcgaaacgtaagattacctttttatggaacaaagcttcaataatcataagttgtgtgata |
384 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10164559 |
accaaactcaagagagtcataaattgagggaagattggcatt-aaacgtaagattacctttttgtggaacaaagcttcaataatcataagttgtctgata |
10164657 |
T |
 |
| Q |
385 |
gtagtatatgctcgtgaaacattgtatttgatgcaatatg |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10164658 |
gtagtatatgctcgtgaaacattgtatttgatgcaatatg |
10164697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University