View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7033_low_15 (Length: 315)
Name: NF7033_low_15
Description: NF7033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7033_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 26348394 - 26348098
Alignment:
| Q |
1 |
tggtgtaacgaattttgaacaacttaggaaattgcattatttacgagcagcagcacatgaaagtatgagactatatccaccaattcaatttgattcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348394 |
tggtgtaacgaattttgaacaacttaggaaattgcattatttacaagcagcagcacatgaaagtatgagactatatccaccaattcaatttgattcaaag |
26348295 |
T |
 |
| Q |
101 |
ttttgtttggatgatgatgttttaccagatggtacaaaagtgaaaagtggtactagggttacttatcatccttatgcaatgggtaggttggaggaattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348294 |
ttttgtttggatgatgatgttttaccagatggtacaaaagtgaaaagtggaactagggttacttatcatccttatgcaatgggtaggttggaggaattgt |
26348195 |
T |
 |
| Q |
201 |
ggggtccagattgtttagagtttaagcctgaaaggtggttgaaagatggtgtgtttcaaccttcaaatcaattcaagtaccctatttttcaagctgg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348194 |
ggggtccagattgtttagagtttaagcctgaaaggtggttgaaagatggtgtgtttcaaccttcaaatcaattcaagtaccctatttttcaagctgg |
26348098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University