View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7033_low_17 (Length: 308)
Name: NF7033_low_17
Description: NF7033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7033_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 163 - 285
Target Start/End: Original strand, 11226960 - 11227082
Alignment:
| Q |
163 |
tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtatttgggtagatg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11226960 |
tcaagtgatgagatgtattatgggaaattggttgacatcatagaacttgattactatggtaagctgagggttgtgcttttcaagtgtgtttgggtagata |
11227059 |
T |
|
| Q |
263 |
ctagacctaacaagggaattaag |
285 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11227060 |
ctagacctaacaagggaattaag |
11227082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University