View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7033_low_20 (Length: 250)
Name: NF7033_low_20
Description: NF7033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7033_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 44699468 - 44699259
Alignment:
| Q |
19 |
gaaccgtgacggatagcttcgacccacggtggaacgaacagtacacatggcaggtatatgatccttgcactgtcttaaccgtaggtgtatttgacaactg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44699468 |
gaaccgtgacggatagcttcgacccacggtggaacgaacagtacacatggcaggtatatgatccttgcactgtcttaaccgtaggtgtatttgacaactg |
44699369 |
T |
 |
| Q |
119 |
gcgtatgtttgctgatgtggcagaagaaaaaccagattgccgtataggcaaaattcgtatacgggtatccactctagagagcaataaaatctacacaagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44699368 |
gcgtatgtttgctgatgtggcagaagaaaaaccagattgccgtataggcaaaattcgtatacgggtatccactctagagagcaataaaatctacacaagt |
44699269 |
T |
 |
| Q |
219 |
tcctatccat |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
44699268 |
tcctatccat |
44699259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University