View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7033_low_27 (Length: 244)
Name: NF7033_low_27
Description: NF7033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7033_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 36749502 - 36749725
Alignment:
| Q |
1 |
acaaaactactaccattgtcataaggacaaatatgcctcattgttttcctttataattctgccatagtgagactgagccaattttgctattaaactggac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36749502 |
acaaaactactaccattgtcataaggacaaatatgcctcattgttttcctttataattctgccatagtgagactgagccaagtttgctattaaactggac |
36749601 |
T |
 |
| Q |
101 |
caccacagagtatgttaacgggattgctctgccctagaactagaagcacacctaagcgaatttgggggatattccatcaacaccgcgagatgacaaccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36749602 |
caccacagagtatgttaacgggattgctctgccctagaactagaagcacacctaagcgaatttgggggatattccatcaacaccgcgagatgacaaccaa |
36749701 |
T |
 |
| Q |
201 |
gtaatcatcatcaacaggtcatca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36749702 |
gtaatcatcatcaacaggtcatca |
36749725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University